View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_high_42 (Length: 277)
Name: NF15659_high_42
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_high_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 36958679 - 36958466
Alignment:
| Q |
10 |
tgagatgaagatgaataacaacatttcatcctctaaaatttaagcacagtggaaatgtgcaatgatgggaacaaacaggcaatttatgcactcccttttt |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36958679 |
tgagatgaagatgaataaca---tttcatcctctaaaatttgagcccagtggaaatatgcaatgatgggaacaaacaggcaatttatgcactcccttttt |
36958583 |
T |
|
| Q |
110 |
ctatttttattctctaaaattttatattgtattaccccaaaagttgggaaatatatctgcaattaagatgttgaattaatgatgacgagttgaagactat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36958582 |
ctatttttattctctaaaattttatattgtattacccccaaagttgggaaatatatctgaaattaagatgttgaattgatgatgacgagttgaagactat |
36958483 |
T |
|
| Q |
210 |
gctaatcagctaaagct |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36958482 |
gctaatcagctaaagct |
36958466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 261
Target Start/End: Complemental strand, 36957985 - 36957948
Alignment:
| Q |
224 |
gcttcatatgtccatgtgtcaatgtatatgcagaatct |
261 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36957985 |
gcttcatatgttcatgtgtcaatgtatatgcagaatct |
36957948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University