View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_high_53 (Length: 249)
Name: NF15659_high_53
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 36011260 - 36011022
Alignment:
| Q |
1 |
tatttatggattccttatacaatgttttagcgccatgatcctaaaataaagggnnnnnnngattcaatgttagagtgattgttttttgaccgatataccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011260 |
tatttatggattccttatacaatgttttagcgcgatgatcctaaaataaagggaaaaaaagattcaatgttagagtgattgttttttgaccgatataccc |
36011161 |
T |
 |
| Q |
101 |
tcacgtctgtctcatttccaccattatcatcacacacacattcgatcaatccatcagttgatccattccaacaaacaacatggatagggtattctcagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011160 |
tcacgtctgtctcatttccaccattatcatcacacacacattcgatcaatccatcagttgatccattccaacaaacaacatggatagggtattctcagtg |
36011061 |
T |
 |
| Q |
201 |
gacgaaatccccgaccatctttggtcaccgcagattcat |
239 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36011060 |
gacgaaatccccgaccatctatggtcaccgcagattcat |
36011022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University