View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_high_60 (Length: 238)
Name: NF15659_high_60
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_high_60 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 28785100 - 28785321
Alignment:
| Q |
18 |
aaacatatctgtctctacctacttatgatactaataaatgctttttacattatagtagcagtatagtatatcactgaaatgaaatgttgcccttttattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28785100 |
aaacatatctgtctctacctacttatgatactaataaatgctttttacattatagtagcagtatagtatatcactgaaatgaaatgttgcccttttattt |
28785199 |
T |
 |
| Q |
118 |
ttgac-nnnnnnnnnnnntgatagcgcaatgtttctttctacttttaagtttttcacacatgaatggatggatcattaagttttactacttcacagccaa |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28785200 |
ttgacaaaaaaataaaaatgatagcgcaatgtttctttctacttttaagtttttcacacatgaatggatggatcattaagttttactacttcacagccaa |
28785299 |
T |
 |
| Q |
217 |
cacatttatcaacttttcgctt |
238 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
28785300 |
cacatttatcaacttttagctt |
28785321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University