View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_high_67 (Length: 226)
Name: NF15659_high_67
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_high_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 46892739 - 46892523
Alignment:
| Q |
1 |
tttctcatcatagttttagtggtcttttttatagttggttagcaacctgccatcatatggaaggtgaagcacacataactctctatggaacttctaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892739 |
tttctcatcatagttttagtggtcttttttatagttggttagcaacctgccatcatatggaaggtgaagcacacataactctctatggaacttctaaatt |
46892640 |
T |
 |
| Q |
101 |
ccaaatcttctagcacacatataactcatattattaataagataatttatgagtctagaattcaattgagaagctttcataaatcttactatgaataaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892639 |
ccaaatcttctagcacacatataactcatattattaataagataatttatgagtctagaactcaattgagaagctttcataaatcttactatgaataaaa |
46892540 |
T |
 |
| Q |
201 |
tacagtttggttctctg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46892539 |
tacagtttggttctctg |
46892523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 46874815 - 46874743
Alignment:
| Q |
143 |
taatttatgagtctagaattcaattgagaagctttcataaatcttactatgaataaaatacagtttggttctc |
215 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
46874815 |
taatttatgagtcttgaactcatttgagaagctttcataaatcttacaacgaataaaatacagtttggttctc |
46874743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University