View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_high_68 (Length: 224)
Name: NF15659_high_68
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 181
Target Start/End: Original strand, 34544989 - 34545156
Alignment:
| Q |
18 |
taattttatatataaaattaagttttttaatacttgcaaatgtcttttacaattttcaaactctcaatatgcatattaagttacattatgataatgtctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
34544989 |
taattttatatataaaattaagttttttaatacttgcaaatatcttttacatttttcaaactcctaatatgcatattaagttacattatgataatgtccg |
34545088 |
T |
 |
| Q |
118 |
caacgtgaataacatgca----tttttgcacatcgaactcattctatttatttcaacttaattctgat |
181 |
Q |
| |
|
||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34545089 |
caacgcgaataacgtgcagatttttttgcacatcgaactcattctatttatttcaacttagttctgat |
34545156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University