View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_high_70 (Length: 222)
Name: NF15659_high_70
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_high_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 204
Target Start/End: Original strand, 5978829 - 5979020
Alignment:
| Q |
14 |
attattctctactcaaatagaaggcgtcgtgatgcttagacttttattagtcaattttcttagagttggg-ataatctttggtgtatggatggatgcctt |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5978829 |
attattctctacccaaatagaaggcgtcgtgatgcttagacttttattagacaattttcttagagttggggataatctttggtgtatggatggatgcctt |
5978928 |
T |
 |
| Q |
113 |
tattaacattatggtacaagtgaaaaaagaagttgagttaagcgatctatgtggcttattaatggttttagagaggcaatcgtggatgttgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5978929 |
tattaacattatggtacaagtgaaaaaagaagttgaattaagcgacctatgtggcttattaatggttttagagaggcaatcgtggatattgg |
5979020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University