View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_25 (Length: 382)
Name: NF15659_low_25
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 233 - 358
Target Start/End: Original strand, 1232100 - 1232228
Alignment:
| Q |
233 |
aacaaattgtagaaaatggtgaaaaagggtaacgaagaacaattgatttaatggtgaaaaatctctctcacctttat---ttgttgatgatgaggaagaa |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
1232100 |
aacaaattgtagaaaatggtgaaaaagggtaacgaagaacagtgaattcaatggtgaaaaatctctctcacctttatttgttgttgatggtgaggaagaa |
1232199 |
T |
|
| Q |
330 |
acaagattgatttgtgttaatttgaacca |
358 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
1232200 |
acaagattggtttgtgttaatttgaacca |
1232228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 7955043 - 7954980
Alignment:
| Q |
4 |
ctgtgtatgtggtgttgttctgttgaggtcgcaggaggagggtggtggatggtggagagaacgg |
67 |
Q |
| |
|
||||||||||||||||||||||| || |||| ||||||||||||||||| ||| ||||| |||| |
|
|
| T |
7955043 |
ctgtgtatgtggtgttgttctgtcgatgtcggaggaggagggtggtggacggtagagagtacgg |
7954980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University