View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_52 (Length: 257)
Name: NF15659_low_52
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_52 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 36 - 257
Target Start/End: Complemental strand, 5400514 - 5400292
Alignment:
| Q |
36 |
tagaattaatttagtaaaatcaattgtagttaaaagtaatttaa-gataaaatggtttacgtacgattcatgtacatgaaaatgaattgaacaagtataa |
134 |
Q |
| |
|
|||||| ||||| ||||||| ||||||| |||||||||| |||| ||||||||| |||| ||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
5400514 |
tagaatgaattttgtaaaattaattgtatttaaaagtaagttaaagataaaatgatttatgtacgattcattttcatgaaaatgaattgaacaagtataa |
5400415 |
T |
 |
| Q |
135 |
aaaatgatgtttgtagacacaatttagaaatcatagcttcatgttagaatcaactataaagacaaaattaattgtaattgaaaagttccaaacatactaa |
234 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5400414 |
aaaaacatgtttgtagacaaaatttagaaatcatagctttatgttagaatcaattataaagacaaaattaattgtaattgaaaagctccaaacatactaa |
5400315 |
T |
 |
| Q |
235 |
atcaattttaagtccttagaaac |
257 |
Q |
| |
|
|||||||||||| | |||||||| |
|
|
| T |
5400314 |
atcaattttaagcctttagaaac |
5400292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University