View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_60 (Length: 239)
Name: NF15659_low_60
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 110 - 228
Target Start/End: Original strand, 34382041 - 34382159
Alignment:
| Q |
110 |
tgaatacatggaccctgagggtggctggatggtaccatccgtggccgcggttgatgttggtccaatgttgaatttttggtggttactggtttgtgcaaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34382041 |
tgaatacatggaccctgagggtggctggatggtactatccgtggccgcggttgatgttggtccaatgttgaatttttggtggtaactggtttgtgcaaag |
34382140 |
T |
 |
| Q |
210 |
aaggagattggtgatgatg |
228 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
34382141 |
aaggagattgatgatgatg |
34382159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University