View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_66 (Length: 237)
Name: NF15659_low_66
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 16824584 - 16824362
Alignment:
| Q |
1 |
aactttttgtaattattatttggtcnnnnnnn-ctttttatttatgttgtaataagactatttataccttattttaatttgtaattgtgataacatttgt |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16824584 |
aactttttgtaattattatttggtcaaaaaaaactttttatttatgttgtaataagactatttataccttattttaatttgtaattgtgataacatttgt |
16824485 |
T |
 |
| Q |
100 |
agttatagtgattataaatattgcagaaaattgtgataaaatattgtctaaattgaagtggtgttgcattttgttcaacatcaaaaaatttatgtcatgg |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16824484 |
agttatagtgattctaaatattgcagaaaattgtgataaaatattgtctaaatagaagtggtgttgcattttgttcaacatcaaaaaatttatgtcatgg |
16824385 |
T |
 |
| Q |
200 |
tcaagattgtgattgtagaaatt |
222 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
16824384 |
tcgagattgtgattgtagaaatt |
16824362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University