View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_67 (Length: 236)
Name: NF15659_low_67
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_67 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 89 - 236
Target Start/End: Complemental strand, 36011466 - 36011321
Alignment:
| Q |
89 |
atttcttcaagtgatgaagataatcaatatgaaactaaaaatttgatgacatacatatatacataataatattcctaataatacccgaatacaactcata |
188 |
Q |
| |
|
|||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36011466 |
atttcttcaagtgatggagataattaataggaaactaaaaatttgatgacatacatata--cataataatattcctaataatacccgagtacaactcata |
36011369 |
T |
 |
| Q |
189 |
tgataaaaagttatagaaatatcttacatgcggaagatgatttcaaac |
236 |
Q |
| |
|
||||||||| |||||||| |||||||||| | |||||||| ||||||| |
|
|
| T |
36011368 |
tgataaaaaattatagaagtatcttacatccagaagatgagttcaaac |
36011321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 16 - 66
Target Start/End: Complemental strand, 36011519 - 36011469
Alignment:
| Q |
16 |
tattaaacatcgaagaacattcaagaactaactcctccttccactacaaca |
66 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36011519 |
tattaaacaacgaagaacattcaagaactaactcctcctcccactacaaca |
36011469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University