View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_76 (Length: 219)
Name: NF15659_low_76
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 29 - 201
Target Start/End: Complemental strand, 39027216 - 39027044
Alignment:
| Q |
29 |
tgttaaagggtatcttgtgtgcagtagggtcacatgggaatggagaaggaatggacagctatgaacagctgggaagagggactcaacggtgtaactggaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39027216 |
tgttaaagggtatcttgtgtgcagtagggtcacatgggaatggagaaggaatggacagctatgaacagctgggaagagggactcaacggtgtaactggaa |
39027117 |
T |
 |
| Q |
129 |
agtcgccagtggatttaatagctagtgggaatcagccaccacgtgcccttgtgaccttctctttagtgacatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39027116 |
agtcgccagtggatttaatagctagtgggaatcagccaccacgtgcccttgtgaccttctctttagtgacatg |
39027044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University