View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15659_low_76 (Length: 219)

Name: NF15659_low_76
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15659_low_76
NF15659_low_76
[»] chr2 (1 HSPs)
chr2 (29-201)||(39027044-39027216)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 29 - 201
Target Start/End: Complemental strand, 39027216 - 39027044
Alignment:
29 tgttaaagggtatcttgtgtgcagtagggtcacatgggaatggagaaggaatggacagctatgaacagctgggaagagggactcaacggtgtaactggaa 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39027216 tgttaaagggtatcttgtgtgcagtagggtcacatgggaatggagaaggaatggacagctatgaacagctgggaagagggactcaacggtgtaactggaa 39027117  T
129 agtcgccagtggatttaatagctagtgggaatcagccaccacgtgcccttgtgaccttctctttagtgacatg 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39027116 agtcgccagtggatttaatagctagtgggaatcagccaccacgtgcccttgtgaccttctctttagtgacatg 39027044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University