View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_77 (Length: 210)
Name: NF15659_low_77
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 46503510 - 46503327
Alignment:
| Q |
12 |
gcagagaggaagctcacgtttgaaagcatcgattttgagacgttcttcttctaagcgagaaacaaattcttcgagtttgtagctttgatcactttgttct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503510 |
gcagagaggaagctcacgtttgaaagcatcgattttgagacgttcttcttctaagcgagaaacaaattcttcgagtttgtagctttgatcactttgttct |
46503411 |
T |
 |
| Q |
112 |
ccaaatgatttcagtaacatggagtagctatgtggcttgcaatccaagcctagttcagatgatgaagccattctttgttaaaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503410 |
ccaaatgatttcagtaacatggagtagctatgtggcttgcaatccaagcctagttcagatgatgaagccattctttgttaaaaa |
46503327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University