View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_78 (Length: 208)
Name: NF15659_low_78
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 13 - 185
Target Start/End: Complemental strand, 41532207 - 41532034
Alignment:
| Q |
13 |
attatactgtttttgtacaaaattgaaatattagaagatgtcatagtatgtgtttgtcatgtccaaacattttctaaaaatagaggtcttgagccattat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41532207 |
attatactgtttttgtacaaaattgaaatattagaagatgtcatagtatgtgtttgtcttgtccaaacattttctaaaaatagaggtcttgagccattat |
41532108 |
T |
 |
| Q |
113 |
aataaaatttgtttgacgcatttataaatcatatctaac-nnnnnnnntgatcgtctattgactctacgatcaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41532107 |
aataaaatttgtttgacgcatttataaataatatctaacaaaaaaaaatgatcgtctattgactctacgatcaa |
41532034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University