View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15659_low_79 (Length: 207)
Name: NF15659_low_79
Description: NF15659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15659_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 46892985 - 46892814
Alignment:
| Q |
20 |
agttaattgtgattctattgtaaactcttgattagagtggttatatataatcttgttttcgttatatctatgatttattcaatgtcttagtgaaatggta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892985 |
agttaattgtgattctattgtaaactcttgattagagtggttatatataatcttgttttcgttatatctatgatttattcaatgtcttagtgaaatggta |
46892886 |
T |
 |
| Q |
120 |
tgttagattagatctcgtgttgtttatccggaagggtgacaagggtctttgttgattcacgtaggatttcat |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46892885 |
tgttagattagatctcgtgttgtttgtccggaagggtgacaagggtctttgttgattcacataggatttcat |
46892814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University