View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_low_17 (Length: 271)
Name: NF1565_low_17
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1565_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 41883737 - 41883475
Alignment:
| Q |
1 |
acatgtactaataagaataattttgtgactttaacatgaaggaaaggagccatcaggtttggtaacaacttgaatttcagaaattaagctagaatttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41883737 |
acatgtactaataagaataattttgtgactttaacatgaaggaaaggagccatcaggtttggtaacaacttgaatttcagaaattaagctagaatttcaa |
41883638 |
T |
 |
| Q |
101 |
tggcaacagcaatgggaagtgacagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttattatcacatggacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41883637 |
tggcaacagcaatgggaagtgacagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttattatcacatggacaag |
41883538 |
T |
 |
| Q |
201 |
atgaatgttgtaggtggtacctgcaaaattcactactgccgcaacagtcaagtgcttcatctc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
41883537 |
atgaatgttgtaggtggtacctgcaaaattcactactgccgcaacagtcaggtgcttcttctc |
41883475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 95 - 187
Target Start/End: Complemental strand, 10267796 - 10267704
Alignment:
| Q |
95 |
tttcaatggcaacagcaatgggaagtgacagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttatta |
187 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
10267796 |
tttcaatggcaacaccaatgggaagtgacacatggaaagcccatttggctatggcaatggtgcagctattcaatggtggttaccacgttatta |
10267704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 10267958 - 10267915
Alignment:
| Q |
21 |
ttttgtgactttaacatgaaggaaaggagccatcaggtttggta |
64 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
10267958 |
ttttgtgactttaacacgaaggaaaggaaccatcaggtttggta |
10267915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 255
Target Start/End: Original strand, 36372315 - 36372343
Alignment:
| Q |
227 |
aattcactactgccgcaacagtcaagtgc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36372315 |
aattcactactgccgcaacagtcaagtgc |
36372343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University