View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_low_25 (Length: 244)
Name: NF1565_low_25
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_low_25 |
![](./plan/images/spacer.gif) | ![NF1565_low_25](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 14100401 - 14100161
Alignment:
Q |
1 |
ttatcaacatgaatttttcacaaaattacaactcggagtagctgttagttttaattttaaaagatcaatgtcaaaaatcaaagttggtgaatttgtattg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14100401 |
ttatcaacatgaatttttcacaaaattacaactcggagtagctgttagttttaattttaaaagatcaatgtcaaaaatcaaagttggtgaatttgtattg |
14100302 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
gagcaccggtgtcaaatttcatggcattgattagtttgacttcttaataaaacaaacaatgttaaacaaactgatcagagaaaatcaagatgtt----gc |
196 |
Q |
|
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
14100301 |
gagcaccggtgtcaaattccatggcatggattagtttgacttcttaataaaacaaacaatgttaaacaaactgatcagagaaaatcaagatgttgcttgc |
14100202 |
T |
![](./plan/images/spacer.gif) |
Q |
197 |
ttcctttttaaaacctctttcaattccattcatctcgagaa |
237 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14100201 |
ttcctttttaaaacctctttcaattccattcatctcgagaa |
14100161 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7136 times since January 2019
Visitors: 1243