View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15660_low_5 (Length: 237)
Name: NF15660_low_5
Description: NF15660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15660_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2571975 - 2572195
Alignment:
| Q |
1 |
ttcatcatcagatacagaactagttgataaaattgaaagctatctaagtgctgtagctactaaccattacacttgctatgatggtttggttgtgacaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2571975 |
ttcatcatcagatacagaactagttgataaaattgaaagctatctaagtgctgtagctactaaccattacacttgctatgatggtttggttgtgacaaaa |
2572074 |
T |
|
| Q |
101 |
agtaacattgctaatgctcttgctgttccattgaaagatgctacacaattttacagtgtttcacttggattggttactgaggctttgagtaaaaatatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2572075 |
agtaacattgctaatgctcttgctgttccattgaaagatgctacacaattttacagtgtttcacttggattggttactgaggctttgagtaaaaatatga |
2572174 |
T |
|
| Q |
201 |
aaaggaataagacacgcaaac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2572175 |
aaaggaataagacacgcaaac |
2572195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 41 - 198
Target Start/End: Complemental strand, 16609927 - 16609770
Alignment:
| Q |
41 |
tatctaagtgctgtagctactaaccattacacttgctatgatggtttggttgtgacaaaaagtaacattgctaatgctcttgctgttccattgaaagatg |
140 |
Q |
| |
|
||||| |||||||| |||||||| ||||| ||||| | |||||| ||||||||||| |||||||||||||||||||| |||||||| ||||||| ||| |
|
|
| T |
16609927 |
tatcttagtgctgtggctactaatcattatacttgttttgatgggttggttgtgactaaaagtaacattgctaatgcacttgctgtgccattgagtaatg |
16609828 |
T |
|
| Q |
141 |
ctacacaattttacagtgtttcacttggattggttactgaggctttgagtaaaaatat |
198 |
Q |
| |
|
||||||||| || ||| |||||||||| |||| ||| | ||||||||||||||||| |
|
|
| T |
16609827 |
ttacacaattatatagtatttcacttgggttggccactcaagctttgagtaaaaatat |
16609770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University