View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15662_high_12 (Length: 222)
Name: NF15662_high_12
Description: NF15662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15662_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 3 - 205
Target Start/End: Original strand, 36289805 - 36290007
Alignment:
| Q |
3 |
agcaggattttcaggatcaattgatcttcacttagacgggagctctataaataatgcagaactttcactcttcaattttagtagcattataattgcaaca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36289805 |
agcaggattttcaggatcaattgatcttcacttagacgggagctctataaataatgcagaactttcactcttcaattttagtagcattataattgcaaca |
36289904 |
T |
|
| Q |
103 |
aacaatttctcagaagaaaacaagcttggacaagggggatttggtcctgtttacaaggtaaacatgtggctgttaaacataccttactgtaatatgttaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||| |||||||||||||| |
|
|
| T |
36289905 |
aacaatttctcagaagaaaacaagcttggacaagggggatttggtcctgtctacaaggtaaacatgtaactgttaaacttacctttctgtaatatgttaa |
36290004 |
T |
|
| Q |
203 |
aat |
205 |
Q |
| |
|
||| |
|
|
| T |
36290005 |
aat |
36290007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 163
Target Start/End: Original strand, 21935833 - 21935876
Alignment:
| Q |
120 |
aaacaagcttggacaagggggatttggtcctgtttacaaggtaa |
163 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
21935833 |
aaacaagcttggacaaggtgggtttggtcctgtctacaaggtaa |
21935876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University