View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15662_low_10 (Length: 328)
Name: NF15662_low_10
Description: NF15662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15662_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 3109236 - 3109000
Alignment:
| Q |
16 |
acaacaatttctttctctttcactcttgtactttgataacaatattcaatgttaatagttactttatgttgaaaaattgatatt------aaaattgaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3109236 |
acaacaatttctttctctttcactcttgtactttgataacaatattcaatgttaatagttactttatgttgaaaaattgatattgatattaaaattgaaa |
3109137 |
T |
 |
| Q |
110 |
gggagagaaagagaaacaaagaaccaaaactcagtggcagctgagaaatgctaaaaaatcagac----ttaccttaccctaatgtttcattgtttat--- |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
3109136 |
gggagagaaagagaaacaaagaaccaaaactcagtggcagctgagaaatgctaaaaaatcagacttacttaccttaccctaatatttcattgtttattat |
3109037 |
T |
 |
| Q |
203 |
-tatttattgtatataaaaaatttagagggacaaaat |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3109036 |
atatttattgtatataaaaaaattagagggacaaaat |
3109000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University