View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15662_low_11 (Length: 301)
Name: NF15662_low_11
Description: NF15662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15662_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 47 - 288
Target Start/End: Complemental strand, 17794849 - 17794608
Alignment:
| Q |
47 |
cacttcatctaattcaaaaataaatatcaaacattgtttgcatcgattgagtacgtggataacacatcaaccatagatgagtgcaatagattattttgtg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17794849 |
cacttcatctaattcaaaaataaatatcaaacattgtttgcatcgattgagtacgtggataacacatcaaccatagatgagtgcaatagattattttgtg |
17794750 |
T |
 |
| Q |
147 |
cttcaaataaagcttcgatctattttgagggagatggtgtatattttaaggggagggtagggcagagagacaggttgggaaagaaaacgtacacctacaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17794749 |
cttcaaataaagcttcgatctattttgagggagatggtgtatattttaaggggagggtagggcagagagacaggttgggaaagaaaacgtacacctacaa |
17794650 |
T |
 |
| Q |
247 |
gcaaagcaaagaaagaaacaacccaccaagtgacccttatat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17794649 |
gcaaagcaaagaaagaaacaacccaccaagtgacccttatat |
17794608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University