View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15663_high_25 (Length: 237)
Name: NF15663_high_25
Description: NF15663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15663_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 6937720 - 6937926
Alignment:
| Q |
16 |
atgaaggaccgggatagcaatagaggggcattcattacttctcagctacgaccttagaggatctgggcagagaaagtcctacttctgaaggagcaatgct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6937720 |
atgaaggaccgggatagcaatagaggggcattcattacttctcagttacgaccttagaggatctgggcagagaaagtcctacctctgaaggagcaatgct |
6937819 |
T |
|
| Q |
116 |
ctgtggttagttaggaatctacttcccagcttcattttatcttcttcatcaataatacaacccccctttcatcattccatgtattatgacccattgtcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6937820 |
ctgtggttagttaggaatctacttcccaacttcattttatcttcttcatcaataatacaacccccctttcatcattccatgtattatgacccattgtcat |
6937919 |
T |
|
| Q |
216 |
tattatt |
222 |
Q |
| |
|
||||||| |
|
|
| T |
6937920 |
tattatt |
6937926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 26 - 142
Target Start/End: Complemental strand, 4245139 - 4245023
Alignment:
| Q |
26 |
gggatagcaatagaggggcattcattacttctcagctacgaccttagaggatctgggcagagaaagtcctacttctgaaggagcaatgctctgtggttag |
125 |
Q |
| |
|
|||||||||||||||| | |||||| ||| |||| |||||||| ||| | | ||||||||||||||||| |||||||||||| |||||||||| ||| |
|
|
| T |
4245139 |
gggatagcaatagaggaggattcatcactgttcagttacgacctaagaaggtttgggcagagaaagtcctttctctgaaggagcagtgctctgtgggtag |
4245040 |
T |
|
| Q |
126 |
ttaggaatctacttccc |
142 |
Q |
| |
|
||||| |||| |||||| |
|
|
| T |
4245039 |
ttagggatcttcttccc |
4245023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University