View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15663_low_23 (Length: 255)
Name: NF15663_low_23
Description: NF15663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15663_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 238
Target Start/End: Original strand, 31351856 - 31352093
Alignment:
| Q |
3 |
tcaaacttactgcacgctcaacacatggtcttgtttagaggagaaatagaagtgagctagacatggaaacaagtatgttaaagcagaagaagttgccacg |
102 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31351856 |
tcaaacttactacacgctcaacacatggtcttgtttagaggagaaatagaagtgagctagacatggaaacaagtatgttaaagcagaagaagttgccacg |
31351955 |
T |
 |
| Q |
103 |
tgaattatagggagaagcagtgatcactgcaacttaaatcttgaaaaaatgtcctaataagaagttgaagacaatggttcatgagaaagggtggttagaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31351956 |
tgaattatagggagaagcagtgatcactgcaacttaaatcttgaaaaaatgtcctaataagaagttgaagacaatggttcatgagaaagggtggttagaa |
31352055 |
T |
 |
| Q |
203 |
ggaaagcatgatgtcactc--attttagagtatttgat |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31352056 |
ggaaagcatgatgtcactcatattttagagtatttgat |
31352093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University