View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15663_low_25 (Length: 239)
Name: NF15663_low_25
Description: NF15663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15663_low_25 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 30541586 - 30541807
Alignment:
| Q |
18 |
attgcaaacaaacaaatcaaactaacacttgctccaagaatacatgtccaaattagcgtttgcaacagaacataaaaactttccttctttaaaacctttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30541586 |
attgcaaacaaacaaatcaaactaacacttgctccaagaatacatgtccaaattagcgtttgcaacagaacataaaaactttccttctttaaaacctttt |
30541685 |
T |
 |
| Q |
118 |
caaatgatagttgcattaaacatagtaaaagtgcataccctgctgatggaccaaaagtacacaaaaaaccaatcatgtgctttatcttagtaaagttaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30541686 |
caaatgatagttgcattaaacatagtaaaagtgcataccctgctgatggaccaaaagtacacaaaaaaccaatcatgtgctttatcttagtaaagttaat |
30541785 |
T |
 |
| Q |
218 |
ttcttttgttttataattctct |
239 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
30541786 |
ttcttttgttttataatcctct |
30541807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University