View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15663_low_30 (Length: 224)
Name: NF15663_low_30
Description: NF15663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15663_low_30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 22 - 224
Target Start/End: Complemental strand, 33599120 - 33598918
Alignment:
| Q |
22 |
aacaaatctattttgtgtgtttattcacattaaaaataaattttgaataaatattttgtagctttcgaaggcttcttgatgcgctaaacgctcatatagt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| | |
|
|
| T |
33599120 |
aacaaatctattttgtgtgtttattcacattaaaaataaattttgaataaatattttgtagctttcgaaggcttcttgatgcgctgaacgctgatataat |
33599021 |
T |
 |
| Q |
122 |
aattctttttcttaagcttactctgtattttaaggtaatacactacactctgatacttacatgtttatattagatttagattgttggaaattgaaattat |
221 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33599020 |
aattctttttcttaagcttactccgtattttaaggtaatacactacactctgatacttacatgtttatattagatttagattgttggaaattgaaattat |
33598921 |
T |
 |
| Q |
222 |
att |
224 |
Q |
| |
|
||| |
|
|
| T |
33598920 |
att |
33598918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University