View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15663_low_31 (Length: 219)
Name: NF15663_low_31
Description: NF15663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15663_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 24453564 - 24453759
Alignment:
| Q |
16 |
aatatctttataatgtatgtctccttgtgtaagtttggggggt-------tattatttaagaaacatgatggtggattttgtgctgtattctttcacnnn |
108 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
24453564 |
aatatctttataatgtatgtccccttgtgtaagtttggggggtggggggttattatttaagaaacatgatggtggattttgtgttgtattatttcacttt |
24453663 |
T |
|
| Q |
109 |
nnnnccctggatatttgaaactaggggaaagcttcgacatggagctatttgattagtatgtttcgtaaactttattttggttggataggtggattg |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24453664 |
ttttccctggatgtttgaaactaggggaaagcttcgacatggagctatttgattagtatgtttcgtaaactttattttggttggataggtggattg |
24453759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University