View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15664_high_13 (Length: 319)
Name: NF15664_high_13
Description: NF15664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15664_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 23 - 304
Target Start/End: Complemental strand, 34594486 - 34594205
Alignment:
| Q |
23 |
cacagaaccgaaagaaatgggtcagaagcagaagcacgctttgaaatcagatcccaacgatgaaaccaagaagaaacgccgtgttggattttccggcata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34594486 |
cacagaaccgaaagaaatgggtcagaagcagaagcacgctttgaaatcagatcccaacgatgaaaccaagaagaaacgccgtgttggattttccggcata |
34594387 |
T |
|
| Q |
123 |
ggcgagttttctttatatttttactca-nnnnnnnngaatttgtttcgtcattttgctgtgatttatacgata-ttttcattgcgttttgtagatgctgg |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34594386 |
ggcgagttttctttatatttttactcattttttgttgaatttgtttcgtcattttgctgtgatttatacgatatttttcattgcgttttgtagatgctgg |
34594287 |
T |
|
| Q |
221 |
agttgaggccaaagactgcatcagaatcttccttggtatgatcaannnnnnnnngaaagattcatttttctttagtgaagtttt |
304 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34594286 |
ggttgaagccaaagactgcatcagaatcttccttggtatgatcaa--tttttttgaaagattcatttttctttagtgaagtttt |
34594205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University