View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15664_high_25 (Length: 227)
Name: NF15664_high_25
Description: NF15664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15664_high_25 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 35 - 227
Target Start/End: Complemental strand, 17145211 - 17145019
Alignment:
| Q |
35 |
agaagggtcaagatgaatagtggaaaaatggggacattaagcttgtttgtactactacttgaagtaaaagtttctccaaatatttatttatctcttcatc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17145211 |
agaagggtcaagatgaatagtggaaaaatggggacattaagcttgtttgtactactacttaaagtaaaagtttctccaaatatttatttatctcttcatt |
17145112 |
T |
 |
| Q |
135 |
tatgagtgtacttgtctttcctttaattaatctctttgataatctttaaagattatatctcgtactcggattccgtgcactaaaaatatcacg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
17145111 |
tatgagtgtacttgtctttcctttaattaatctctttcataatctttaaagattctatctcgcactcgaattatgtgcactaaaaatatcacg |
17145019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University