View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15664_low_22 (Length: 255)
Name: NF15664_low_22
Description: NF15664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15664_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 992991 - 993186
Alignment:
| Q |
13 |
aatattgtccttaatttatttcgatgcaaattatttgagtaatatgaaataaaaatccgagtattatggttctcataatatcatttccaaatagaatatc |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
992991 |
aatattgtccttaatttatttggatgcaaattatttgagtaatatgaaataaaaatccgagtattatggttctcataatagcatttccaaatagaatatc |
993090 |
T |
 |
| Q |
113 |
gaatannnnnnnnaagggtaccatcgaaaatttattgactgtaaattgcaaaatattttannnnnnnatgaaaataagtcacatatcataatcaat |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
993091 |
gaatattttttttaagggtaccatcgaaaatttattgactgtaaattgcaaaatattttatttttttatgaaaataagtcacatatcataatcaat |
993186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University