View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15664_low_23 (Length: 241)
Name: NF15664_low_23
Description: NF15664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15664_low_23 |
 |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 26825836 - 26826060
Alignment:
| Q |
1 |
ttagggcaatttgtgactgtgcagatgacttcatatggaactacaaattagtaaactcaacatagctaacaaacaagtgtatatagttttaaacttgtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26825836 |
ttagggcaatttgtgactgtgcagatgacttcatatggaactacaaattagtaaactcaacatagctaacaaacaagtgtatatagttttaaacttgtac |
26825935 |
T |
 |
| Q |
101 |
cagatatgcttatttctaccgtctttttaaagttatcttacaacgacataattannnnnnncaagtaaaactatcttgatgttcaaatacagtaatagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26825936 |
cagatatgcttatttctaccgtcttttaaaagttatcttacaacgatataattatttttttcaagtaaaactatcttgatgttcaaatacagtaatagtt |
26826035 |
T |
 |
| Q |
201 |
ttactactctttggataggcaatat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26826036 |
ttactactctttggataggcaatat |
26826060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 63
Target Start/End: Complemental strand, 18851943 - 18851914
Alignment:
| Q |
34 |
tatggaactacaaattagtaaactcaacat |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18851943 |
tatggaactacaaattagtaaactcaacat |
18851914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 63
Target Start/End: Complemental strand, 61060 - 61028
Alignment:
| Q |
31 |
tcatatggaactacaaattagtaaactcaacat |
63 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
61060 |
tcatatggaactaaaaattagtaaactcaacat |
61028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University