View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15664_low_24 (Length: 240)
Name: NF15664_low_24
Description: NF15664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15664_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 26 - 208
Target Start/End: Complemental strand, 6441259 - 6441082
Alignment:
| Q |
26 |
tattacatatgaagagagcgatttttacaaagttatgtattagaaatatgcaaataatagcataaatattatctttagcagtactgatctctacagattt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6441259 |
tattacatatgaagagagcgatttttacaaagt-----attagaaatatgcaaataatagcataaatattatctttagcagtactgatctctacatattt |
6441165 |
T |
|
| Q |
126 |
tttgttgctgaaagaatctctatagaggttaaaaagcaacatatatacaaagagacagaaaataataattaaaggcaagaaaa |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6441164 |
tttgttgttgaaagaatctctatagaggttaaaaagcaacatatatacaaagagacagaaaataataattgaaggcaagaaaa |
6441082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University