View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15664_low_25 (Length: 237)
Name: NF15664_low_25
Description: NF15664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15664_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 1848043 - 1847838
Alignment:
| Q |
18 |
aggagtttgaagtgcatgatggtgacag-cgttgatctggtagtgatggaagattgcgattgaatttgatggagtgacgcgtgtcaaaattaatcatttg |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1848043 |
aggagtttgaagtgcatgatggcgacagtcgttgatctggtagtgatggaagactgcgattgaatttgatggagtgacacgtgtcaaaattaatcatttg |
1847944 |
T |
 |
| Q |
117 |
tagggttccgagttcttacaagctttctttaaacccaaaaagaccattgagttgatcatttgtaagctcctaaagcttaaacggatttgggtccaactaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1847943 |
tagggttccgagttcttacaagctttctttaaacccaaaaaaaccattgagttgatcatttgtacgctcctaaagcttaaacggatttgggtccaactaa |
1847844 |
T |
 |
| Q |
217 |
gaatta |
222 |
Q |
| |
|
||||| |
|
|
| T |
1847843 |
aaatta |
1847838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University