View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15666_low_12 (Length: 374)
Name: NF15666_low_12
Description: NF15666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15666_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 19 - 359
Target Start/End: Complemental strand, 2489498 - 2489158
Alignment:
| Q |
19 |
gcttctcaaactcattatcaggaacttcctgcaagtgaagagattgtgttgtgtttgaataagccacttgcggtatgatttcaacactattaaaattaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489498 |
gcttctcaaactcattatcaggaacttcctgcaagtgaagagattgtgttgtgtttgaataagccacttgcggtatgatttcaacactattaaaattaaa |
2489399 |
T |
 |
| Q |
119 |
ttgtaatatatctaataattagaaaacagagaaggcttacagctttggatgcaggaactgaattttcaccatcagttttgcgcactgaagttggtatttc |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489398 |
ttgtaatatatctaacaattagaaaacagagaaggcttacagctttggatgcaggaactgaattttcaccatcagttttgcgcactgaagttggtatttc |
2489299 |
T |
 |
| Q |
219 |
tgcttcagtctttacagcaggagcaggactttcagtctttccttctggtttcacagcagctccttcctcttttttctttattcgggatgatacatacaga |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489298 |
tgcttcagtctttacagcaggtgcaggactttcagtctttccttctggtttcacagcagctccttcctcttttttctttattcgggatgatacatacaga |
2489199 |
T |
 |
| Q |
319 |
gacaaaggacacacagattatatcagtacctggtagatatt |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489198 |
gacaaaggacacacagattatatcagtacctggtagatatt |
2489158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University