View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15666_low_21 (Length: 271)
Name: NF15666_low_21
Description: NF15666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15666_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 44041956 - 44041719
Alignment:
| Q |
14 |
tgagatgaataccctctaagaatttctgcctgcaaaaatgctcaataaagtcaaatcagtagtcccagacatcatcatcactagaatctaagcccaaatc |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041956 |
tgagatggataccctctaagaatttctgcctgcaaaaatgctcaataaagtcaaatcagtagtcccagacatcatcatcactagaatctaagcccaaatc |
44041857 |
T |
 |
| Q |
114 |
agatatctgacctgagcaatattccatattgcaagagataaagaggcagtggctaggaagagacccccaatgacccagttactggtttctgctaatagag |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041856 |
agatatctcacctgagcaatattccatattgcaagagataaagaggcagtggctaggaagagacccccaatgacccagttactggtttctgctaatagag |
44041757 |
T |
 |
| Q |
214 |
accagaatggttgcgatgtagagggttgagtttgaatg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041756 |
accagaatggttgcgatgtagagggttgagtttgaatg |
44041719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University