View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15667_high_10 (Length: 379)
Name: NF15667_high_10
Description: NF15667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15667_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 34620038 - 34619678
Alignment:
| Q |
1 |
accaacaaacagcgtctattgttgcttgagtttgtcggtgtcacttctgttgaggagaggtattgtactatattgcatttgcttatattttttggaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34620038 |
accaacaaacagcgtctattgttgcttgagtttgtcggtgtcacttctgttgaggagaggtattgtactatattgcatttgcttataatttttggaagaa |
34619939 |
T |
|
| Q |
101 |
gattgcatttgcttatatgatttctaaggatgaagaaaacgtcacttgagctctagagaagtggcgtgatatgtcgaaatctctaggtaacgctcccaag |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34619938 |
gattgcatttgcttatatgatatctaaggaggaagaaaacgtcacttgagctctagagaagtggcgtgatatgtcgaaatctctaggtaacgctcccaag |
34619839 |
T |
|
| Q |
201 |
gtaattctgactaactgagataatgctctacatgaatgttgttgtcacagttttacttaactctactaagctgctgctttggtatcatatctcaaaacat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34619838 |
gtaattctgactaactgagataatgctctagatgaatgttgttgtcacagttttacttaactctactaagctactgctttggtatcatatctcaaaacat |
34619739 |
T |
|
| Q |
301 |
gtcaaaggaagatgtaagacagattgcaaagtcaaagctctcaattataaggaagggaaag |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34619738 |
gtcaaaggaagatgtaagacagattgcaaagtcaaagctctcaattataaggaagggaaag |
34619678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 10349913 - 10349958
Alignment:
| Q |
3 |
caacaaacagcgtctattgttgcttgagtttgtcggtgtcacttct |
48 |
Q |
| |
|
||||||| | ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10349913 |
caacaaatatcgtcttttgttgcttgagtttgttggtgtcacttct |
10349958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University