View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15667_high_15 (Length: 326)
Name: NF15667_high_15
Description: NF15667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15667_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 305
Target Start/End: Original strand, 35993729 - 35994017
Alignment:
| Q |
17 |
aggagtaacattctatgtgtggttgtttgattcaggcttgatgattgttgatgagtctgattgaggcattcgaaaaattgctgatgctagagatataggc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35993729 |
aggagtaacattctatgtgtggttgtttgattcaggcttgatgattgttgatgagtctgattgaggcatacgaaaaattgctgatgctagagatataggc |
35993828 |
T |
 |
| Q |
117 |
attatgcaaagtgccttggattgaagaagttgcatagctgcaccaacatcttcttccataagtttagcaacttgttgttctgttccatcgttcgaccact |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35993829 |
attatgcaaagtgccttggattgaagaagttgcatagctgcaccaacatcttcttccataagtttggcaacttgttgttctgttccatcgttcgaccact |
35993928 |
T |
 |
| Q |
217 |
tcgcccaggcttgctggttggttccaccttctatgtcctccccctgcatgcagatcatatagaggtgtgtcagaacctattaaacattt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35993929 |
tcgcccaggcttgctggttggttccaccttctatgtcctccccctgcatgcagatcatatagagttgtgtcagaacctattaaacattt |
35994017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 93 - 223
Target Start/End: Original strand, 31380879 - 31381009
Alignment:
| Q |
93 |
attgctgatgctagagatataggcattatgcaaagtgccttggattgaagaagttgcatagctgcaccaacatcttcttccataagtttagcaacttgtt |
192 |
Q |
| |
|
||||| ||||| || || || |||||||||||||| ||||| |||||||||| ||||| || || ||||||| ||||||||| || ||||| ||||| | |
|
|
| T |
31380879 |
attgcagatgccagtgagatgggcattatgcaaagagcctttgattgaagaaactgcatcgcagccccaacattttcttccatgagcttagctacttgct |
31380978 |
T |
 |
| Q |
193 |
gttctgttccatcgttcgaccacttcgccca |
223 |
Q |
| |
|
|||||| ||||| || ||||||||| |||| |
|
|
| T |
31380979 |
tttctgtgccatcattagaccacttctccca |
31381009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University