View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15667_high_22 (Length: 237)
Name: NF15667_high_22
Description: NF15667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15667_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 603476 - 603593
Alignment:
| Q |
1 |
acatgtagagtgcaagaaaacgtaccctggcctggtacttggtttggtttaa------gtgtggatgagagtcatgcatgttggcttggcttagagagct |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
603476 |
acatgtagagtgcaagaaaacgtaccctgacctggtacttggtttggtttcactttcagtgtggatgagagtcatgcatgttggcttggcttagagagct |
603575 |
T |
|
| Q |
95 |
ctgaaaaaatgcaacctc |
112 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
603576 |
ctgaaaaaatgcaacctc |
603593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 603651 - 603697
Alignment:
| Q |
175 |
tatttgttatacctatataatatacctttcttcgatttagaaggaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
603651 |
tatttgttatacctatataatataccttttttcgatttagaaggaaa |
603697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University