View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15667_high_22 (Length: 237)

Name: NF15667_high_22
Description: NF15667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15667_high_22
NF15667_high_22
[»] chr1 (2 HSPs)
chr1 (1-112)||(603476-603593)
chr1 (175-221)||(603651-603697)


Alignment Details
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 603476 - 603593
Alignment:
1 acatgtagagtgcaagaaaacgtaccctggcctggtacttggtttggtttaa------gtgtggatgagagtcatgcatgttggcttggcttagagagct 94  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||| |      ||||||||||||||||||||||||||||||||||||||||||    
603476 acatgtagagtgcaagaaaacgtaccctgacctggtacttggtttggtttcactttcagtgtggatgagagtcatgcatgttggcttggcttagagagct 603575  T
95 ctgaaaaaatgcaacctc 112  Q
    ||||||||||||||||||    
603576 ctgaaaaaatgcaacctc 603593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 603651 - 603697
Alignment:
175 tatttgttatacctatataatatacctttcttcgatttagaaggaaa 221  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||    
603651 tatttgttatacctatataatataccttttttcgatttagaaggaaa 603697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University