View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15667_low_10 (Length: 420)
Name: NF15667_low_10
Description: NF15667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15667_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 48578302 - 48578109
Alignment:
| Q |
1 |
cgctgcggtgttggtgggcggtggaggccaaaccagaaagatcccgcagaaccaaacaaagagagtggaagaaaattgggttgcacgcacaagagagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48578302 |
cgctgcggtgttggtgggcggtggaggccaaaccagaaagatcccgcagaaccaaacaaagagagtggaagaaaattgggttgcgcgcacaagagagaga |
48578203 |
T |
|
| Q |
101 |
aggaactgggcggatcgtgtgacagtgagagggaagcagggtgtgtgtcaggtgtggcgcagtggaggtgcttgggaagctgctgccggcaaca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48578202 |
aggaactgggcggatcgtgtgacagtgagagggaagcagggtgtgtgtcaggtgtggcgcagtggaggtgcttgggaagctgctgccggcaaca |
48578109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 256 - 399
Target Start/End: Complemental strand, 48578052 - 48577909
Alignment:
| Q |
256 |
tggattgagtcctgggtcaaaggtgcaaaacaaaatttcagagttcaatatgcaaaagatatagggtagcatggcatttgcagtttttaatagttcaggg |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48578052 |
tggattgagtcctgggtcaaaggtgcaaaacaaaatttcagagttcaatatgcaaaagatatagggtagcatggcatttgcagtttttaatagttcaggg |
48577953 |
T |
|
| Q |
356 |
tgtgcaagtgcacccctcactaatacatgggtccccctctgcat |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48577952 |
tgtgcaagtgcacccctcactaatacatgggtccccctctgcat |
48577909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University