View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15667_low_20 (Length: 257)
Name: NF15667_low_20
Description: NF15667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15667_low_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 43856177 - 43856429
Alignment:
| Q |
1 |
cgaggagaaggttttgattggtggatagggtttggttgtgtgtggggatacgtagttgtttttcgatgattgttttgaggtctgagacggttttgttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43856177 |
cgaggagaaggttttgattggtggatagggtttggttgtgtgtggggatacgtagttgtttttcgatgattgttttgaggtctgagacggttttgttgtt |
43856276 |
T |
|
| Q |
101 |
tggattatcgagtgttactcgttctagaccatctcggcttcgaattctgagcatcatggtttctgttttggttattttgtgt-gatgatgattgagaatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43856277 |
tggattatcgagtgttactcgttctagaccatctcggcttcgaattctgagcatcatggtttatgttttggttattttgtgtggatgatgattgagaatg |
43856376 |
T |
|
| Q |
200 |
atgaagaaagaattgggggtttttatgaatgaatggaatatagaagagttgagaataa |
257 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
43856377 |
atgaagaaagaattggggttttt-----atgaatggaatatagaagagttgagaataa |
43856429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 69 - 125
Target Start/End: Original strand, 25127125 - 25127181
Alignment:
| Q |
69 |
attgttttgaggtctgagacggttttgttgtttggattatcgagtgttactcgttct |
125 |
Q |
| |
|
||||||||||| ||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
25127125 |
attgttttgagttctgaaacggttatggtgtttggattatcgagtgttactcgttct |
25127181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 125
Target Start/End: Complemental strand, 3030069 - 3030018
Alignment:
| Q |
74 |
tttgaggtctgagacggttttgttgtttggattatcgagtgttactcgttct |
125 |
Q |
| |
|
|||||| ||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3030069 |
tttgagttctgaaacggttatggtgtttggattatcgagtgttactcgttct |
3030018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University