View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15668_low_11 (Length: 252)
Name: NF15668_low_11
Description: NF15668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15668_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 30 - 181
Target Start/End: Complemental strand, 32715987 - 32715836
Alignment:
| Q |
30 |
taaccgcttttctaacaaccttgaatccgttttattttccatttacctgttgtccttaaattacttaagtttgtcatggnnnnnnnnnncttccttgaaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
32715987 |
taaccgcttttctaacaaccttgaatccgttttattttccatttagctgttgtccttaaattacttaagtttttcatttttttttttttcttatttgaaa |
32715888 |
T |
|
| Q |
130 |
aatatactgttgatcatcgtagaataacgaaaagcacttatcacaacctgct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32715887 |
aatatactgttgatcatcgtagaataacgaaaagcacttatcacaacctgct |
32715836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 108
Target Start/End: Complemental strand, 47266116 - 47266040
Alignment:
| Q |
30 |
taaccgcttttctaacaaccttgaatccgttttattttccatttacctgttgtccttaaattacttaagtttgtcatgg |
108 |
Q |
| |
|
|||||| ||||| |||||| |||||||| ||| |||||||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
47266116 |
taaccgtttttccaacaactttgaatccattt-attttccatttacctgttgt-gttaaattactctagtttttcatgg |
47266040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University