View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15668_low_15 (Length: 216)

Name: NF15668_low_15
Description: NF15668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15668_low_15
NF15668_low_15
[»] chr8 (2 HSPs)
chr8 (25-150)||(13537521-13537646)
chr8 (25-150)||(13627069-13627194)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 150
Target Start/End: Complemental strand, 13537646 - 13537521
Alignment:
25 tttataagcccttgattttctatcggactcaaatttttaggctgcatttgcaagtttggagagtggaggaaaggaaacttttagagggttgaaaatatat 124  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||    
13537646 tttataagcccttgattttctatcggactcaaatttttaggatgcatttccaagtttggagagtggaggaatggaaacttttagagggttgaaaatatat 13537547  T
125 nnnnnnnntatggtaaaatcttttaa 150  Q
            ||||||||||||||||||    
13537546 aaaaaaaatatggtaaaatcttttaa 13537521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 150
Target Start/End: Complemental strand, 13627194 - 13627069
Alignment:
25 tttataagcccttgattttctatcggactcaaatttttaggctgcatttgcaagtttggagagtggaggaaaggaaacttttagagggttgaaaatatat 124  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||    
13627194 tttataagcccttgattttctatcggactcaaatttttaggatgcatttccaagtttggagagtggaggaatggaaacttttagagggttgaaaatatat 13627095  T
125 nnnnnnnntatggtaaaatcttttaa 150  Q
            ||||||||||||||||||    
13627094 aaaaaaaatatggtaaaatcttttaa 13627069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University