View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15668_low_15 (Length: 216)
Name: NF15668_low_15
Description: NF15668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15668_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 150
Target Start/End: Complemental strand, 13537646 - 13537521
Alignment:
| Q |
25 |
tttataagcccttgattttctatcggactcaaatttttaggctgcatttgcaagtttggagagtggaggaaaggaaacttttagagggttgaaaatatat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13537646 |
tttataagcccttgattttctatcggactcaaatttttaggatgcatttccaagtttggagagtggaggaatggaaacttttagagggttgaaaatatat |
13537547 |
T |
|
| Q |
125 |
nnnnnnnntatggtaaaatcttttaa |
150 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13537546 |
aaaaaaaatatggtaaaatcttttaa |
13537521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 150
Target Start/End: Complemental strand, 13627194 - 13627069
Alignment:
| Q |
25 |
tttataagcccttgattttctatcggactcaaatttttaggctgcatttgcaagtttggagagtggaggaaaggaaacttttagagggttgaaaatatat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13627194 |
tttataagcccttgattttctatcggactcaaatttttaggatgcatttccaagtttggagagtggaggaatggaaacttttagagggttgaaaatatat |
13627095 |
T |
|
| Q |
125 |
nnnnnnnntatggtaaaatcttttaa |
150 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13627094 |
aaaaaaaatatggtaaaatcttttaa |
13627069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University