View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15668_low_7 (Length: 312)
Name: NF15668_low_7
Description: NF15668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15668_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 181 - 305
Target Start/End: Complemental strand, 8336306 - 8336182
Alignment:
| Q |
181 |
tattatagaacaacaatttattcacgtttatttaaatgagttaacttcattttatttactacctttgtaaatattatttgcctaaacatatatctccaaa |
280 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8336306 |
tattatagaacaacaatttattcatgtttatttaaatgagttaacttcattttatttactacctttgtaaatattatttgcccaaacatatatctccaaa |
8336207 |
T |
|
| Q |
281 |
cacaactattacttgctcacctttg |
305 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8336206 |
cacaactattacttgctcacctttg |
8336182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University