View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15669_high_14 (Length: 244)
Name: NF15669_high_14
Description: NF15669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15669_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 70 - 137
Target Start/End: Complemental strand, 33626144 - 33626077
Alignment:
| Q |
70 |
cacttcaatgacttttgggcgccaaaggcatgtgcctttgccccaataatcacttgccacctgtccct |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
33626144 |
cacttcagtgacttttgggcgccaaaggcatgtgcctttgccccaataatcacttaccacatgtccct |
33626077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 70 - 137
Target Start/End: Original strand, 33624517 - 33624584
Alignment:
| Q |
70 |
cacttcaatgacttttgggcgccaaaggcatgtgcctttgccccaataatcacttgccacctgtccct |
137 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
33624517 |
cacttcaatgacttttgaacgccaaaggcatgtgcctttaccccaataatcacctgccatgtgtccct |
33624584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 21848754 - 21848799
Alignment:
| Q |
19 |
aattggtccacatctcctgttcttatcgtttctgttgttgtagttg |
64 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
21848754 |
aattggtccacatctcctgttctgattgtttctgttgttgtagttg |
21848799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 1220226 - 1220271
Alignment:
| Q |
19 |
aattggtccacatctcctgttcttatcgtttctgttgttgtagttg |
64 |
Q |
| |
|
||||||| ||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
1220226 |
aattggttcacatctcctgttatgattgtttctgttgttgtagttg |
1220271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University