View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15669_high_15 (Length: 238)
Name: NF15669_high_15
Description: NF15669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15669_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 16339011 - 16338798
Alignment:
| Q |
10 |
atgaaagcctgtaatgatcattatccgccctcgtctgatggtaaataccgccagacgaactgaatagcattacatggtctgaaatcattgccccgctcac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16339011 |
atgaaagcctgtaatgatcattatccgccctcgtctgatggtaaataccgccagacgaactgaatagcattacatggtctgaaatcattgccccgctcac |
16338912 |
T |
|
| Q |
110 |
atgctcaaaacttatactcaattcgtgtcttctgtctccgtgattatatacagtacaactaactccggaagaagcaagatttaacccctcagagagaaag |
209 |
Q |
| |
|
|||||||||||||||| || || || |||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16338911 |
atgctcaaaacttatattccatccgccgcttctgtctccgtgattatatatagtacaattaactccggaagaagtaagatttaacccctcagagagaaag |
16338812 |
T |
|
| Q |
210 |
acgcataaaacaat |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16338811 |
acgcataaaacaat |
16338798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 10 - 224
Target Start/End: Original strand, 16120177 - 16120388
Alignment:
| Q |
10 |
atgaaagcctgtaatgatcattatccgccctcgtctgatggtaaataccgccagacgaactgaatagcattacatggtctgaaatcattgccccgctcac |
109 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| ||||| | || ||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16120177 |
atgaaaggctgtaatgatcattatccaccctcgtctgatggcaaatagc---aggcgaacagattagcagtacatggtctgaaatcattgccccgctcac |
16120273 |
T |
|
| Q |
110 |
atgctcaaaacttatactcaattcgtgtcttctgtctccgtgattatatacagtacaactaactccggaagaagcaagatttaacccctcagagagaaag |
209 |
Q |
| |
|
|| | |||||||||||||| |||||| |||||||||||||||||||||| ||||||| |||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
16120274 |
attcacaaaacttatactccattcgttgcttctgtctccgtgattatatatagtacaatcaactccggaaaaagtaagatttaacccctcagagagaaag |
16120373 |
T |
|
| Q |
210 |
acgcataaaacaatt |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16120374 |
acgcataaaacaatt |
16120388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University