View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15669_low_13 (Length: 283)
Name: NF15669_low_13
Description: NF15669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15669_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 262
Target Start/End: Complemental strand, 3338411 - 3338149
Alignment:
| Q |
2 |
gggttgtgggatccaccatgagtgcattggatggagcatannnnnnnnnnnn--gccgacaaagggcatctttggatgcatgggttttagtatttgcgca |
99 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338411 |
gggttgtggggtccaccatgagtgcattggatggagcataagagagagagagaggccgacaaagggcatctttggatgcatgggttttagtatttgcgca |
3338312 |
T |
 |
| Q |
100 |
cgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttcagagatttcagagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338311 |
cgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttcagagatttcagagt |
3338212 |
T |
 |
| Q |
200 |
aattcagctaactcttcggtgctttccactgtctttttgtgatctctgttctcttcctctctc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338211 |
aattcagctaactcttcggtgctttccactgtctttttgtgatctctgttctcttcctctctc |
3338149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University