View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15669_low_15 (Length: 244)

Name: NF15669_low_15
Description: NF15669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15669_low_15
NF15669_low_15
[»] chr5 (3 HSPs)
chr5 (70-137)||(33626077-33626144)
chr5 (70-137)||(33624517-33624584)
chr5 (19-64)||(21848754-21848799)
[»] chr7 (1 HSPs)
chr7 (19-64)||(1220226-1220271)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 70 - 137
Target Start/End: Complemental strand, 33626144 - 33626077
Alignment:
70 cacttcaatgacttttgggcgccaaaggcatgtgcctttgccccaataatcacttgccacctgtccct 137  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||    
33626144 cacttcagtgacttttgggcgccaaaggcatgtgcctttgccccaataatcacttaccacatgtccct 33626077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 70 - 137
Target Start/End: Original strand, 33624517 - 33624584
Alignment:
70 cacttcaatgacttttgggcgccaaaggcatgtgcctttgccccaataatcacttgccacctgtccct 137  Q
    |||||||||||||||||  |||||||||||||||||||| ||||||||||||| |||||  |||||||    
33624517 cacttcaatgacttttgaacgccaaaggcatgtgcctttaccccaataatcacctgccatgtgtccct 33624584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 21848754 - 21848799
Alignment:
19 aattggtccacatctcctgttcttatcgtttctgttgttgtagttg 64  Q
    ||||||||||||||||||||||| || |||||||||||||||||||    
21848754 aattggtccacatctcctgttctgattgtttctgttgttgtagttg 21848799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 1220226 - 1220271
Alignment:
19 aattggtccacatctcctgttcttatcgtttctgttgttgtagttg 64  Q
    ||||||| ||||||||||||| | || |||||||||||||||||||    
1220226 aattggttcacatctcctgttatgattgtttctgttgttgtagttg 1220271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University