View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15669_low_19 (Length: 220)
Name: NF15669_low_19
Description: NF15669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15669_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 64 - 219
Target Start/End: Original strand, 2521791 - 2521946
Alignment:
| Q |
64 |
tattattcaggttgtgagctcaagatgttggcctcaaatctctcgttacaaagctgtagtccgcactcagtcgtcaaaagtagagatcgttcagtctcta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2521791 |
tattattcaggttgtgagctcaagatgttggcctcaaatctctcgttacaaagctgtagtccgcactcagtcgtcaaaagtagagatcgttcagtctcta |
2521890 |
T |
 |
| Q |
164 |
ttcaagcctgtttctgatactaaggatgacggtatcatcaggttcgtgttttctaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2521891 |
ttcaagcctgtttctgatactaaggatgacggtatcatcaggttcgtgttttctaa |
2521946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University