View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_43 (Length: 214)
Name: NF1566_low_43
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_low_43 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 22232414 - 22232246
Alignment:
Q |
1 |
ttaactaaaattaatttatttaaaatgaagttttcttaccctagaatcaaattcaatctcaatttcttatcatttcttttcattgcacctctcacacact |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22232414 |
ttaactaaaattaatttatttaaaatgaagttttcttaccctagaatcaaattcaatctcaatttcttatcatttcttttcattgcacctctcacacact |
22232315 |
T |
|
Q |
101 |
acaatgtttatcctgccataataaactgtccataaataagttagtaatagttttctgttgatatgatat |
169 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22232314 |
acaatgtttatcctgccataataaactgtccataaataagttagtaatagttttctgttgatatgatat |
22232246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 158 - 213
Target Start/End: Complemental strand, 22232227 - 22232172
Alignment:
Q |
158 |
ttgatatgatatgatatcatatgaaggcttgtaatatgaatatccgacaaacatag |
213 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22232227 |
ttgatatgatatcatatcatatgaaggcttgtaatatgaatatccgacaaacatag |
22232172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5460 times since January 2019
Visitors: 1241