View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1567-INSERTION-2 (Length: 232)
Name: NF1567-INSERTION-2
Description: NF1567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1567-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 43231668 - 43231490
Alignment:
| Q |
10 |
tatttacttgattcccatgcttaactcttcatcctttacattgacatcttaataaattcgattttgtttgtttaatttgctgaatcgatgtgttggctgg |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
43231668 |
tatttacttgattcccacgcttaactcttcatcctttacattgacatcttaataaattcgattttgtttgttt-----gctgaatcgatgcgttggctgg |
43231574 |
T |
 |
| Q |
110 |
ttgtttctgtcgggttgttgattctttaaatactcgtgtattgttcaaggtatgtttgtttggcttttcatttgaagcatttgg |
193 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43231573 |
ttgtttctgtcgtgttgttgattctttaaatactcgtgtattgttcaaggtatgtttgtttggcttttgatttgaagcatttgg |
43231490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University