View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15671_high_7 (Length: 223)
Name: NF15671_high_7
Description: NF15671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15671_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 40048292 - 40048484
Alignment:
| Q |
16 |
tgaagaaccccgctttgagatgcgagaaagctgagtcatccggtgccaagattgttaatccgccgctttttggtgatatgagttgtgagtttaggttgtc |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40048292 |
tgaagaaccctgctttgagatgcgagaaagctgagtcatccggtgccaagattgttaatccgccgctttttgctgatatgagttgtgagtttaggttgtc |
40048391 |
T |
 |
| Q |
116 |
cacgatttgtgttgttcttaggagacgggttaggattgtgaatgttttcgcctttttgaggatttttgttatgtcgtccggggtggaatctga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40048392 |
cacgatttgtgttgttcttaggagacgggttaggattgtgaatgttttcgcctttttgaggatttttgttatgtcgtccggggtggaatctga |
40048484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 65 - 193
Target Start/End: Complemental strand, 22056210 - 22056082
Alignment:
| Q |
65 |
gattgttaatccgccgctttttggtgatatgagttgtgagtttaggttgtccacgatttgtgttgttcttaggagacgggttaggattgtgaatgttttc |
164 |
Q |
| |
|
||||||||| |||||| |||||| || ||||| || ||||||| | || || ||||| ||||||| ||||||||||| |||||| | |||||||||| |
|
|
| T |
22056210 |
gattgttaagccgccgttttttgctgtgatgagctgcgagtttacgctgctcatgatttctgttgtttttaggagacggattaggacggagaatgttttc |
22056111 |
T |
 |
| Q |
165 |
gcctttttgaggatttttgttatgtcgtc |
193 |
Q |
| |
|
|||||||| |||||| |||| |||||||| |
|
|
| T |
22056110 |
gcctttttaaggattgttgtgatgtcgtc |
22056082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University